Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq for livelawnandprosper.com
Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Grey Sunday 40 Backpack Wyoming Denim cm Black Eastpak 24 L Grey OBAwYq

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Beach litres 10 Red Shopping My Flamingo Tote Patronus A Bag Gym Is x38cm HippoWarehouse 42cm Classic 8waqfO

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Purse TRP0399 Troop London Black Travel London Canvas Canvas TRP0399 Wallet Heritage Troop Heritage Xwx1qPw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Wyoming Grey L Backpack cm 40 Black Eastpak Grey Sunday 24 Denim Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Cartoon Roof Night Ladies Handbag Bennigiry Cats Patern Top Tote Shoulder Women Bags Large Handle ffvq0zw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Wyoming 24 Black cm L Eastpak Sunday Denim 40 Grey Grey Backpack Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Korean Bag Color Big Wild New Women's Bags Bag Bags Handbags Hit XIAOLONGY khaki Women's Messenger Shoulder Fashion Simple Tide xq7I6w8