Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy for livelawnandprosper.com
Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Pu Girls Backpack Lightweight Backpack Bag School Backpack Leather Women Backpack Grey Fashion Mini qYwrq1t


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Rhinestone Diamante Envy Bride I'm Tote Blue Keep calm The Twisted Bag Yd40w4

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Shoulder Tracolla Blue Duck Blue Md20 Women’s Dress Bag Mandarina Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

coin Arles CASTELBAJAC Arles Orange CASTELBAJAC 067601 purse qHBwT4w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Md20 Dress Blue Tracolla Mandarina Shoulder Bag Blue Women’s Duck Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Quality Ladies Small Designer Khaki Bag CWV0026 Fashion Italian Women's Leather Cross Body aq7I7WUr