Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy for livelawnandprosper.com
Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Women’s Mandarina Bag Duck Tracolla Shoulder Blue Md20 Dress Blue rrO5AaWqy

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

For 11" Valentine DailyObjects Zippered MacBook Ballistic Nylon Laptop Sleeve zdqXYx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Dark Woman Leather Made In Leather Shoulder Bag Bag Tuscan Genuine Color Italy Woman Blue Bw7qB8p

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Blue Women’s Shoulder Duck Mandarina Dress Md20 Tracolla Bag Blue Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag KERVINFENDRIYUN Bag Party Color Purse Flower Moonlight Clutch Black Flower Silver Diamond Sun Handbag Evening qgzfq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Blue Shoulder Bag Dress Tracolla Duck Blue Women’s Md20 Mandarina Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bags Women's Wallet Women's Shoulder Simple Wild White Clutch Handbag Handbag Pwq5FY