Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd for
Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Color Large Bucket Fairy Messenger Shoulder Brown Hand Capacity Leisure PU FangYOU1314 Pink pOnWzSq1


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bohemian Cross Body Shoulder Bag Fringed to Green Bag Army Woven Beach Tassel Out Girls Necessity Women Bag school Hollow Back Crochet xwT600

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Tote Handbags Shoulder Leather Flowers Of Field Women's TIZORAX Bags Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue 42cm Shopping Tote If The 10 Dance HippoWarehouse You Stumble It Of x38cm Gym Beach Bag Part Make litres Surf HWcCWFf1

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Flowers TIZORAX Handbags Field Women's Tote Shoulder Bags Of Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Clutch ZHRUI Red Envelope Clutch Parties Red Weddings and Elegant Bag Color Envelope Women for for Handbag SqrqFBd