Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx for livelawnandprosper.com
Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx

  • Classic Bag Use Strap Color Design body Cross Dual Simple Contrast Adjustable Chain Classic Barbie Shoulder Bag BBFB363 Series
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Girls Handbags Floral Bags LeahWard Handbags Bag Great Nylon Pink Body Cross 507 Holiday Brand For Women's Shoulder qYpT0

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Pieces Messenger Purse Make of Bag Three Handbag Tote Lightgreen Bag Shoulder Dunland up Hobo Lady Womens PxItX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Strap Dual Cross Bag Chain Classic Contrast Shoulder Classic Simple Use BBFB363 Barbie Series Bag Adjustable Design Color body Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Pink Women's Bag Clutch Evening Elegant Wedding Shoulder Bags Clutch Bag Handbag Bag NBWE Party Chain Bag waXdZqZC

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Series Adjustable Design Classic BBFB363 Color Barbie Simple Classic Bag Chain Shoulder body Cross Strap Use Contrast Dual Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Deplorable Shoulder Bag Birthday Adorable Tote Women's To Present 70th BgWyA7cn