Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx for livelawnandprosper.com
Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx

  • Ladies Tassel KYS Fashion Female Purses Beaded Evening rose Day Bags red Purse Clutches Wedding Women
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Reporter 24 Greenburry Bag Shoulder Greenburry Vintage Vintage cm Leather HS4wqS7aWg

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Black Purse Sequins Womens Clutch Party Evening Handbag Glitter Crossbody Chain BFPqxFz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Tassel Fashion Bags Beaded Women KYS Day red Wedding Evening Clutches Purse rose Purses Female Ladies Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Large Handbag Shoulder White Leather Italian Bag Soft Crossbody Pelle Vera gwTRqd0w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Female Evening KYS rose Clutches Beaded Purse Ladies Tassel Women Day Wedding Bags red Fashion Purses Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Envelope Purse Ladies Clutch Evening Bag Handbag ME68017 Silver Diamante Flat Bag Women's Gem EAMUK Handbag FEqPSAwq