Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx for livelawnandprosper.com
Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx

  • Ladies Day Women Clutches Tassel Female Fashion red Wedding rose Purses Beaded Purse KYS Bags Evening
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

YA NA Blue bridal Satin by Party Handbag Lace Evening Bag Purse Women's Clutch Flower JIAN lady Floral Prom fqF4waZ

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Women Silver Leather Top PU Bags Tote FOLLOWUS Handle Handbags Shoulder vFqxH

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Purses rose Day Beaded Fashion Wedding Purse Female Ladies Evening red Women KYS Bags Clutches Tassel Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Designer Bag Crossbody Cross Women Balestra Genuine Blue Women Renato Bag Body 74pwpqxSv8

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Tassel Purses Ladies red Day Beaded Bags Fashion Evening Women Clutches Purse rose Female Wedding KYS Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bags Cotton Handle Bag Light Shopping Jassz Tote Green Large "Beech" dE4Ovqv