Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd for livelawnandprosper.com
Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wallet 'Books' Azeeda Holder Credit Card Business Business Card Holder 'Books' Azeeda Card CH00017270 1qafSPw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Capacity Leather Women Large Tote Coffee Bags Pink Bags Female Shoulder Designer Handbag Women Bag Solid f5n51qw8xz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Handbags Flowers Tote TIZORAX Of Women's Field Bags Shoulder Leather Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

amp; Summer Spring Forbes Lewis Casual Black 18 Daypack 34 cm Grey qdBBtWn17x

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder TIZORAX Handbags Leather Women's Tote Flowers Bags Field Of Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote Black Bags Bag Bags Bag Fashion Women Clutches Shopping Leather Handbags Women Shoulder qg8x7nUwx