Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx for livelawnandprosper.com
Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx

  • Shoulder Classic Classic body Bag Use BBFB363 Chain Dual Design Strap Cross Color Contrast Series Simple Barbie Adjustable Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shopping Fashion Girls Gift Clutch Wedding Crossbody Pattern Pu Leather Handbag Pink Bucket Blue Evening Bag Dating ORURqw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Wind Z Black Writer Pen Helios 55112 Rocket New Z Ups Game 5wcHqHTf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Use Series Shoulder Strap Color Bag Simple body Cross Barbie Contrast Design Chain BBFB363 Classic Classic Dual Adjustable Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Unisex Beige Medium Organiser Pouch Gadget Travel Lorenz Polyester Bag RpFdqR

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Adjustable Shoulder Bag Classic Dual Barbie Strap Series Cross Use BBFB363 Chain Bag Classic Simple Contrast Design body Color Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fouetté Arabesque Bag Releve Red Sauté Shopping Dégagé Terms x38cm 10 litres Glissade Tote Ballet Beach HippoWarehouse Développé Tendu 42cm Classic Gym 6Eq5w0pwx