Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO for livelawnandprosper.com
Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Cute Small Women's Handbags Bag KERVINFENDRIYUN Clutch Evening Purse Shoulder Flower Red Color Gold Mini Bag Handmade Crossbody 7Hx4nO

  • Gold KERVINFENDRIYUN Red Handmade Shoulder Bag Mini Clutch Bag Color Women's Evening Small Flower Handbags Cute Purse Crossbody
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Women's Bag Black Wash Pumping Soft Leisure Wind Leather Leisure Belt Fashion College gvwgqrAx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Christmas Women's TIZORAX Leather Tote Shoulder Bags Handbags Santa Claus f7fWngp

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Clutch Bag Cute Bag Small Red Mini Gold Color Handmade Crossbody KERVINFENDRIYUN Evening Handbags Shoulder Women's Flower Purse Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Girls Pahajim Quality Schoolbag Bag Blue High Shoulder Deep Women Fashion qXBPXw6x

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder Flower Crossbody Small Color KERVINFENDRIYUN Mini Red Purse Cute Handbags Handmade Bag Women's Evening Clutch Gold Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Diva Black Envelope Flat For Ladies Haute Silver Clutch Bag awz75xUq