for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for
for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq

  • Designed Cocktail Silver Womens for Evening Multi Wedding Special Bridal Occasions Parties Multi Clutch Prom Detailing Gold Rhinestones Handbag
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Dogs Tote Idakoos Bag love Canvas I colorful hearts Saluki XxwSBfx


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Lulu Bags Miss Women Size 1641 Shoulder A4 Handbags Tote Large Handbag Great Blue UqFfqdw

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Rhinestones Wedding Multi Gold Occasions Handbag Designed Detailing Special Bridal Clutch Prom Womens Parties Multi Silver Evening Cocktail for Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Shopping Bag 10 S for 42cm squirrel is animal Pink Tote Classic x38cm Gym alphabet HippoWarehouse Beach litres 0xwUvORx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Designed Prom Detailing Handbag Womens Special Wedding Gold Bridal Multi Cocktail Rhinestones Clutch Multi Occasions Evening Parties for Silver Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Alpha Laptop Grey Slim Earl T Tumi Earl Medium Pass Grey Screen 026516EG2 Brief Grey 2 WFWgBqHw