fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw for livelawnandprosper.com
fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw

  • Children Students Leather Bow Backpack fPrimary Bags School Zhuhaixmy PU Waterproofrose Pink
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

NBWE Clutches Pink Floral Evening Purses Bag Handbags Women Pearls Clutch Fw5arqxFvz


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Body Dawn Navy Dawn Dark Animal Animal Bag Cross Body Cross UFwq41B4Z

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Waterproofrose fPrimary Zhuhaixmy Bags Children Backpack School Pink Students Bow Leather PU Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Tom Case Card Ford Tom Ford Leather Black Slim Black fqP5FwO

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your PU Zhuhaixmy Students fPrimary Leather Waterproofrose Backpack Bags Children Pink School Bow Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Party Bags I55 Occasion Ladies Womens Blue Clutch Dressy Hand Foldover Pattern Prom Evening Floral 7XwPnxC