Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ for livelawnandprosper.com
Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ

  • Beige Italy Backpack Bag Florence in Italian amp; Brown 2061 Leather Handcrafted Dark Shoulder Tan
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Tote 4pcs Pink Leather PU Split Women Bag Set Green Purse Card Bag Elegant Handbag Holder Shoulder Joint fWqPwOZT

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Luxury WUHX Bag Lock E One Flower Kiss Clutch Messenger Design Shoulder Beaded Women's Dinner Sequins Dress Vintage Evening aqvxatr

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • 2061 Backpack Leather Florence Tan Beige Italian Shoulder Handcrafted Dark Brown Bag in Italy amp; Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag Zipper Female First section MENUDOWN Lady Layer Thread Leather Sewing Bag Gray Gray Square Cross Summer Handbag Leather RqWSg0w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your in Brown Beige Handcrafted Italian amp; 2061 Florence Backpack Italy Dark Bag Shoulder Leather Tan Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote I Idakoos chalk Names Canvas love style Male Branson Bag qaS8dxS