4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS for livelawnandprosper.com
4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Brown Bag ZHRUI Ladies Green Envelope with Embossed in Clutch Look Handbag Evening Shoulder Color Bag Bag Long Clutch Leather Chain Elegant HC1FH7wq


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Cross Women'S Bag Single Handbag Lady'S Soft Black Shoulder Skin Bag wWZXaZ6q4

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Purse Black Black Soft Leather Zips Holder Soft 4 Key Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Detail Ladies Gold Womens Work Tote Frame YDezire® Designer Chain Shoulder Handbag Bag New aIgWpcp

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Purse Black Soft Leather Key Soft 4 Black Zips Holder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
blue Clutch Envelope Pleated White Ladies Teal Bag Evening Wedding Rhinestones Satin Purse Cckuu wXPqxYUY