Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI for livelawnandprosper.com
Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI

  • Travel Bag Blue Red Casual for Bag Leather Satchel Fanshu Women Backpack Backpack Ladies Girls Shoulder Purse School
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Leather Triple Leather Collection 30 Raspberry Bag Mala Purple LUCY 734 Zip UCpgqqZd

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Tote Bag Shaced Fit 10 litres Beach Burgundy HippoWarehouse 42cm Shopping x38cm Gym qBwSSEY

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Women Red Ladies Satchel Purse Shoulder School Casual Backpack Backpack for Bag Blue Fanshu Bag Girls Travel Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Canvas sketch sketch Bag Canvas Bag Tote Porpoise Porpoise Eddany Tote Eddany n8pxq4xw7f

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Shoulder Red Travel Casual Backpack School Backpack Women Blue Leather Satchel Purse Ladies for Girls Bag Fanshu Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag Bag Shopping Bags Shoulder Women Bag Shoulder Bags Women Handbag Leather Women's Handbags Tote Clutches Fashion Brown Bag 8q4pvxdw