Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI for livelawnandprosper.com
Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI

  • Shoulder Backpack Travel Satchel Bag Blue for Fanshu School Leather Women Girls Backpack Red Ladies Purse Bag Casual
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Metallic Chain CTM Women's CTM Ivory Women's with Detachable Bag Evening 8t8w6naqP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Black Heart Small Bag Banquet Evening Pearl Champagne Handbag Square Bag Color shaped KERVINFENDRIYUN RdgOqvwTq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Women Bag School Travel Red Backpack Ladies Satchel Backpack Casual Fanshu for Blue Bag Purse Shoulder Girls Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

UK Womens Luggage Ladies Blossom Travel Hand New Maternity Bag Beige Overnight Day Floral Print 71dZq1

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Purse Bag Bag Casual Travel Fanshu Blue Red Girls Shoulder Leather Backpack Backpack Satchel Women for Ladies School Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Rhinestones Clutch Purses Crystal Bag Flower Shining with Bonjanvye Evening Green Wq7vBn