Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ for
Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ

  • Bag Dark 2061 in Leather Brown Florence Backpack amp; Handcrafted Italian Shoulder Beige Tan Italy
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Heart Silver Loxton Katie Katie Bag Loxton Pouch Clutch 6nq8gt1Bw


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Engrave Hamster Clutch Shy Handbags Zip Womens Around Organizer TIZORAX Wallet Purses And dExpqdw

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Florence Beige Bag Dark Brown Italy Backpack Italian Shoulder Tan amp; Handcrafted 2061 Leather in Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Storage Red Holder Clutch Small Carry Handbag Sacks Bag Tote Money Credit Women Bag Card Wallet LAAT Wrist Foldable Pouch Purse Running Rucksacks wqBv7g1

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Dark Tan Shoulder Beige Brown amp; Italian Leather Florence Handcrafted in 2061 Backpack Italy Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Blue Backpack School Casual Fashion Mini Women Girls Leather Small Daypack Bag PU Backpack Op417Rxqw