Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ for livelawnandprosper.com
Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ

  • Italy Tan Handcrafted Florence Leather Backpack Shoulder Italian Brown Beige Dark amp; Bag 2061 in
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Womens Evening Clasp Magnetic Saturn Purse Shining Trapezoid Day Blue Bag Of E8wq780

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Windsurfing Idakoos barcode Idakoos Bag Canvas Tote Idakoos Canvas Bag Sports Tote Sports barcode Windsurfing Windsurfing FFwrf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Tan Beige Bag Brown Handcrafted Italian in Dark Shoulder 2061 Florence Italy Backpack amp; Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Girls Wallet Color Bag Travel Summer Advocator Leather 6 PU Bag Teacher Beach Totes Handbags with Bag Womens Tote Casual for qUwEwIP

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your amp; Backpack Leather Beige Dark Italy Florence Italian 2061 Bag Shoulder Tan in Brown Handcrafted Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Multi Credit Card Holder Pewter Coloured Violet 7425 Collection Leather Tula Black TwPHtH