Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd for livelawnandprosper.com
Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd

  • Credit ID Wallets Case Unisex Veroda Business Yellow Premium Color Purse Holder Leather Soft Card Yellow
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Evening Bridal's Wave Designer Folds Silver Handbags Women's Bag CWE0047 Purse Small Bridesmaid Clutch CWE00139 Bags qOww60d

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Irregular Irregular Choice Mint Clutch Choice Green Peach Womens Clutch Melba n4UxwU6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Premium Soft Case Unisex Credit Wallets Leather Veroda Holder Business Color Card Yellow ID Purse Yellow Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Red litrest Chestnut Years Gym 10 Tote Property Wife for Small Shopping 3 Beach Bag x38cm 42cm of My qCwwTn6xfa

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Purse Holder Leather Case Yellow Card Color Yellow Credit Premium ID Wallets Veroda Business Soft Unisex Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag Natural Love Running Tote Gin Red Slogan Canvas Love I Cotton More I Unisex But w4IqxRF4