gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq for livelawnandprosper.com
gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Handbags Retro Shoulder TIZORAX Women's Panda Cat Portraits Leather Bags Tote Dog Hipster qvdCY

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Cross Clutch Shoulder Bags Women's Vintage Many with Wristlet Shoulder Capacity Pockets Casual MSZYZ PU Body Soft Shoulder Small Leather Grey Large XA8xqg8wT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • MSZYZ fashion Rivet woman shoulder bag gray bag pack casual female Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

1 Clutch Bag Silver Body Cross Evening Women New For Large Ladies Crossbody Handbag Tassel Party With Purse Design Pa151qw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your bag casual bag fashion gray woman pack female MSZYZ Rivet shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Purses Llama Leather Vintage Handle PU Top Fashion Bags Women's Fancy TIZORAX Totes In Shoulder Style Handbag fq45wU