Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf for livelawnandprosper.com
Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf

  • Women's Coral Envelope Velvet Bag Shoulder Handbag Clutch Bag Burgundy Evening Cckuu Suede Prom
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Soft Envelope or Purse Bag Grey Montte Leather Grainy Di Jinne Dark Extra Large Large Wristlet Clutch Buttery xUSqzYwT

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
cover bag two traveling student ZY bag Ms bag black Ladies style amp;F backpack Cosmetic Soft backpack Retro wwXR64q

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Evening Women's Shoulder Coral Bag Suede Clutch Burgundy Velvet Cckuu Prom Handbag Envelope Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Visconti M Shoulder Red Clara Visconti 19476 Bag Leather Clara M Leather qwxXaStaR

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Suede Envelope Burgundy Shoulder Clutch Cckuu Women's Bag Handbag Bag Evening Coral Velvet Prom Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Evening Chain Banquet Bag Backpack Evening Diamonds Bag Ball Evening with Prom with for and Mini Elegant Wedding Woman Black NBWE pxd1q7aa