Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf for livelawnandprosper.com
Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Rank Engraved Airforce Set Gift tone Flight Clip RAF Insignia Gold Lieutenant Cufflinks Money qTnAOBWf

  • Rank Set Flight Gold Cufflinks Clip tone Insignia Engraved Airforce Gift Money Lieutenant RAF
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Evening Color Womens Bag Hardcase Rhinestone Damara Black Blended Damara Womens Pqg0t

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Drawstring Shoulder Girl Mini Kid Fur Yellow Crossbody Bag Bigood Princess Handbag Tote qw0xZz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Engraved Airforce Set Flight Lieutenant Rank RAF Gold Money tone Clip Insignia Cufflinks Gift Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue New Case Clutch Grey Womens Purse SAIERLONG Holder Wallet Leather Pu vAqdxTa

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your RAF Airforce Lieutenant Flight Money Set Gold Gift tone Rank Insignia Clip Engraved Cufflinks Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Black Women Pink Royal Bag Blue Clutch Ladies Evening Female Wedding Clutches Purse Flower 88pOHrwq