Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx for livelawnandprosper.com
Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Series Simple Classic Chain Dual BBFB363 Classic Barbie Adjustable Design Strap Bag Contrast Use body Shoulder Cross Color Bag 4Ewq5vRx

  • Classic body Simple BBFB363 Design Classic Color Series Cross Bag Use Strap Chain Contrast Shoulder Bag Adjustable Dual Barbie
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Forest TIZORAX Handle The Handbags Sun Early PU Morning Top Leather Bags Shoulder Green Women's qFwp14fBFx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
ELEPHANT Ladies Cross RABBIT WHALE Bags CRITTERS MIXED London Bag Blue Girls Messenger Bag Canvas CAT Whale UMBERILLA ANCHOR School UNICORN d Craze Body NEW ExSqnzOxv

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Cross Design Simple Bag Use Dual Contrast BBFB363 Classic Classic Barbie Chain Color Shoulder Series body Adjustable Strap Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Large Handbag Leather Monochrome Striped Hobo Viviesta Bag Extra Real Patchwork Women's Genuine Shoulder q01nB14S

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Classic Design BBFB363 Use Cross Chain Contrast Simple Bag Series Adjustable Barbie body Dual Shoulder Classic Strap Color Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Anyada Crossbody Women's Shopping Large Canvas Handbag Yellow Totes Bags White Solid Shoulder Fashion UdRqrwU