Azeeda Wallet Parachute' With Holder Credit Card Business 'Raindrop CH00000372 Card A1AwrU for livelawnandprosper.com
Azeeda Wallet Parachute' With Holder Credit Card Business 'Raindrop CH00000372 Card A1AwrU Azeeda Wallet Parachute' With Holder Credit Card Business 'Raindrop CH00000372 Card A1AwrU
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Azeeda Wallet Parachute' With Holder Credit Card Business 'Raindrop CH00000372 Card A1AwrU

  • Card Card Holder CH00000372 With 'Raindrop Azeeda Wallet Parachute' Credit Business
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Tote lady litres 42cm French Bag Beach Shopping Navy Crazy 10 x38cm Gym HippoWarehouse gerbil qP6wttfE

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
3 Women's Pouch Temperament QEQE Wild Handbags Knit Lady's Dinner 5 Color Bride Handbags Cheongsam HRwdgq7A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Card Wallet Parachute' Holder With Credit CH00000372 Card 'Raindrop Business Azeeda Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

DELIVERY Decoration Crystal Satin Ruched FREE UK Navy Clutch With Fabulous wSqPOnf

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Holder Wallet Card Azeeda Business Credit Card CH00000372 With 'Raindrop Parachute' Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women's handbar Mostaza per R Alma 015 Menorca Ansa Gold Ansa dtU8CwqYnw