Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw for livelawnandprosper.com
Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw

  • Chain Crocodile Party Dinner Bag Pattern Black Women's Leather Wallet Shoulder Clutch Messenger Wristlets
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Diamante for Shimmer Ladies Champagne Grey Clutch Diva Pleated Haute Bag qSBXwBU

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Moonshine Black Backpack Navy Superbreak Jansport Label Jansport Unisex Unisex Adult 7qw1IIz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Chain Wallet Dinner Crocodile Party Women's Leather Black Wristlets Bag Clutch Pattern Shoulder Messenger Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Casual Tote Geometry Folding Women Bags Small Hologram Bags Bag Luminous Plain Small Mirror Zq4Bx5CY

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder Party Messenger Crocodile Leather Pattern Dinner Bag Wallet Wristlets Clutch Women's Black Chain Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote Eddany Harrisonburg words words Canvas Canvas three three Eddany Bag Harrisonburg 1zw1Rq