Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd for
Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Leather School Waterproof Rucksacks Fashion 2 Notebooks Bag Backpacks Shoulder Women Pu Style Laptop Girl Grey 4qHwvZ


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Squad Tote Beach Shopping x38cm 42cm Bag 10 Classic Gym Kitty litres Red cat HippoWarehouse q6YwEWt

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Field TIZORAX Tote Leather Of Flowers Handbags Shoulder Bags Women's Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

NYKKOLA Handbags for Small Trendy Purses Cross Cell Ladies Phone Bags Shoulder Body Women Bags qrg0qw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Of Bags Shoulder Field Handbags TIZORAX Leather Tote Flowers Women's Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Toddler Shoulder Child Kanpola Kid Yellow Bookbags Cartoon Backpack Yellow Bags School Kindergaten q177RwZx