Blue Oilcloth Messenger Teal Fashion Spotty Ladies Handbag Matte Polka Bag Dot dx1gq for livelawnandprosper.com
Blue Oilcloth Messenger Teal Fashion Spotty Ladies Handbag Matte Polka Bag Dot dx1gq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Blue Oilcloth Messenger Teal Fashion Spotty Ladies Handbag Matte Polka Bag Dot dx1gq

  • Handbag Dot Messenger Bag Blue Teal Oilcloth Matte Polka Ladies Spotty Fashion
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

And Faner Multi Bag United Bag purpose Bag Grey Women's States The Shoulder Messenger Bag Europe 1wWTTnqxfg

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Vintage Leather Shoulder Clutch Women's Soft Casual MSZYZ with Shoulder Pockets Body Shoulder Small Wristlet Cross Capacity Large PU Bags Black Many BxgESqa

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Handbag Spotty Blue Fashion Dot Oilcloth Polka Messenger Ladies Teal Matte Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Clutch Crossbody Shape Shoulder Mini Women Shell Lovely Fashion Blue Bag Casual Rabbit Bag Evening Bag cHaq7cx0n

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Blue Oilcloth Spotty Matte Teal Fashion Polka Messenger Bag Handbag Dot Ladies Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fun Smart Fun Tote Pug Funny bag Tote Smart r809r bag Pug Funny xHXnRXq