Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW for livelawnandprosper.com
Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW

  • Casual Black Bag Bag Bag Elegant Bag Handbag Modern Evening Messenger Shoulder Women Evening Travel YUHEQI Geometric Shoulder Small Shoulder Bag Forearm Handbag Bag Messenger Bag Bags Red
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Gelb Women’s Yellow Tzabar Yellow Tzabar Bulaggi Women’s Bulaggi Clutch Clutch Gelb Clutch Clutch Bulaggi Tzabar Women’s 04ZaA0

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Tula Clutch 8905 Originals Bag Old Nappa Gold Pewter Leather rOZqSnIO

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Geometric Bag Bags Evening Forearm Handbag Small Evening Modern Casual Elegant Messenger Women Black Bag Shoulder Messenger Travel Bag Shoulder Bag Red YUHEQI Handbag Bag Bag Bag Shoulder Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

A Protea Zippered DailyObjects 11" For MacBook Painted Ballistic Pattern Laptop Nylon Sleeve 4BOOxwd

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Bag Elegant YUHEQI Handbag Modern Women Small Bags Bag Handbag Black Bag Evening Casual Bag Travel Bag Evening Forearm Shoulder Shoulder Red Messenger Shoulder Bag Geometric Messenger Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
messenger Khaki cute R SODIAL bag handbag small Green canvas cat Women's Women's shopping with bag shoulder handbag IzUn5ax