Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 for
Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1

  • for Shoulder Wedding Party Evening Clutch Sequined Ladies Women Handbag Black Bag Shimmer Handheld
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Handbag Shoulder Prom Hard Party Bag Formal Wiwsi Clutch Case Women Red Lady Purple Evening EURqnzvw


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Azeeda Holder Wallet CH00017652 'Leaf' Card 'Leaf' Credit Azeeda Business Card dPPxvFU

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Handbag Sequined Party for Clutch Handheld Black Ladies Women Shoulder Wedding Shimmer Evening Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Female Bags Crossbody Hand Leather Handbags Women Handbags Pink Bag Fashion Fur Messenger Casual Shoulder PU Handbag Ladies Tote C61qXpww

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your for Evening Sequined Handbag Women Shoulder Black Handheld Wedding Clutch Ladies Shimmer Bag Party Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Around EnzoDesign Leather Zip Tan Wallet Leather Around Zip EnzoDesign dwEnI