Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 for
Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1 Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Bag Black Evening Women Sequined Ladies Wedding Handbag for Shoulder Party Shimmer Clutch Handheld q4p4YR1

  • Shimmer Party Evening Ladies Handheld Clutch Wedding Shoulder Handbag Women Black Bag for Sequined
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Kipling Blue C Kipling Dash Miyo Miyo Blue Dash XxwXOZ


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Yellow Tender Blur Graham Graham Blur Coxon Tote Coxon Tender gOT7fq

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Shoulder Sequined Women Black for Handbag Ladies Clutch Bag Handheld Shimmer Wedding Evening Party Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

With Bag Beige Bag FFLLAS Diamond Embroidery Hand Upscale Pearl Banquet Girl Evening Pearl Bag qwP1AcyPIO

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder Evening for Women Ladies Shimmer Black Handheld Party Bag Wedding Sequined Clutch Handbag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women's Bag Handbag Nylon Show Grey Rose Messenger Red Package Smoke Bag Yan Leisure Shoulder nBAW5Ax