Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w for livelawnandprosper.com
Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w

  • Purse Women's Evening Clutch JESSIEKERVIN Handbag Blue Bag Crossbody Pleated
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Designer Leather Ladies Designer Bags Handbags Women's Purses Pink Tote Vintage Purses Shoulder BOSTANTEN Pink p5tHqwgRxx


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Women's Clutch Shoulder Ladies Quilted Pink Party Leather Faux Bag KT657 Evening Handbag BRFUS

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Evening Blue Handbag Bag Clutch JESSIEKERVIN Pleated Women's Purse Crossbody Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Azeeda Holder CH00010503 Credit Card Tree' Business Card 'Curly Wallet f7xrTfaq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Women's Handbag JESSIEKERVIN Pleated Crossbody Purse Blue Clutch Evening Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Zipper Red Wine Coin Holder Phone Domybest Clutch Wristlets Wallet Women PU Handbags Leather wCqf7U