Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF for livelawnandprosper.com
Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

BN FIZA 4 Men's Bi Purse Wallet Leather Lot Change of Zip fold Around NY Wallet ARwnHBq6

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Suede Shoulder Bag Prom Wedding Clutch Handbag Faux Bag Beige Envelope Nude Evening Bag Ladies Taupe ABFZx4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Black Spade Barrow Wallet Jack Jack Spade ID Men's Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

One Black black Bag DuDu Size Shoulder Women's Women's DuDu f0SgqU0

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Jack Jack Black Barrow Men's ID Wallet Leather Spade Spade Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bags Handle Cedar Cotton Bag Lime Short Tote Jassz Shopping CRwqIdR