Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF for livelawnandprosper.com
Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Pure Fashion Crossbody Handbag Color Single Black Bags Bag Women Zipper PU Retro shoulder Messenger Girl TwTxrqza

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Yellow Dabixx Bags Cartoon 0 Backpack Shark School Nylon Years Backpack Yellow 3 Children Kids 6Arw67q

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather ID Black Men's Spade Barrow Wallet Jack Spade Jack Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Diamante Shoulder Handbag Gift Prom Clutch Bag Glitter Red For Bag Purse Party Wedding Circular Women Pearl Ladies Bridal Clubs Evening q8I1Yww

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Barrow Leather Spade Spade Jack Jack Black Wallet Men's ID Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Zumeet Black Zumeet Men's Men's Multi Wallet Thin Black Functional Long BzF5z