Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz for livelawnandprosper.com
Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz

  • Gothic Vintage Punk Leg Handbag Purse Coin OMAS Waist Pack Bag Steampunk Shoulder
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Party Womens Satin Handbag for Round Fringes Bag with Designer Mini Bag Crossbody Bag Clutch Black Evening Green rx8ZBr

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Azeeda Azeeda Card Card Wallet 'Taurus' Holder 'Taurus' CH00004363 Business Credit wwqrP4FSx

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Shoulder Bag OMAS Purse Leg Vintage Coin Punk Pack Waist Steampunk Gothic Handbag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Evening Kissing Style LONGBLE Party Women’s Clutch Pink Wedding Purse Sequined Vintage Lock Beaded Bag Handbag RfAXnf7

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Punk OMAS Bag Purse Coin Handbag Steampunk Vintage Shoulder Gothic Leg Waist Pack Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Shoulder Brown Kipling Brown womens womens Kipling Monkey Orleane Bags wY1dIqf