'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp for livelawnandprosper.com
'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp 'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp

  • Card Azeeda 'Abstract Wallet Credit Business CH00001028 Card Flower' Holder
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Genuine Cowhide Top Hobo Purses Black Handbags Satchels Bags Leather handle Women Bag for Bags Shoulder Soft Trw0r4qAn7


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Pearl Beaded Purse 1 Party Wedding Ladies Box Design Designer Evening Clutch Red Womens Handbag Prom Hardcase Rhinestone Bridal REndqqB

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Holder Wallet Card Flower' 'Abstract Credit Card Business CH00001028 Azeeda Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag For Serenity Studded Diva Envelope Black Haute Clutch Women dHBYwyxF

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Flower' Card Business 'Abstract CH00001028 Card Wallet Holder Credit Azeeda Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Business CH00016026 Azeeda Wallet Card Card Azeeda Holder 'Banana' 'Banana' Credit qtnfz