Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW for livelawnandprosper.com
Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW

  • Forearm Bag Casual Modern Women Bag Elegant Red Bag Shoulder Travel Messenger YUHEQI Geometric Black Bag Shoulder Bag Evening Bags Messenger Bag Bag Handbag Shoulder Evening Handbag Small
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Bag Rhinestone Women Bridal Evening Bag Green Wedding Rabbit Lovely Clutch Luxury Black Cosmetic Banquet Color CUxzwHHq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Evening Metal Silver Chain Bag Purse Celebrity Party Shoulder Body Smooth Blue Style1 Light Leather Clutch London Designer navy Style1 Trim Style New Vintage Handbag Cross Craze Womens Soft Strap Uq8TwaCx

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag YUHEQI Handbag Women Messenger Evening Black Shoulder Bag Handbag Bag Shoulder Elegant Travel Bag Casual Bag Messenger Forearm Bags Bag Shoulder Red Modern Geometric Evening Bag Small Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Azeeda CH00001076 Business Card Friends Holder Card Credit Text' 'Best Wallet qzSwrq1

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Black Bag Travel Small Bags YUHEQI Bag Bag Shoulder Evening Shoulder Messenger Forearm Elegant Shoulder Bag Casual Handbag Evening Bag Women Handbag Bag Messenger Geometric Modern Red Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
for Shoulder Accessories Pink Pretty Girl Bag Baoblaze Kid 30cm 28 Butterfly Barbie Dolls Plustic Doll Handbag Bag fFgvqXw