Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg for livelawnandprosper.com
Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg

  • Bag Numerical Blue Pi Sequence Spreadshirt Tote Maths Light Spreadshirt Pi
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Hand Party Women Sequin bag Prom Wedding Evening Ladies Clutch Green Bridal qq6Sn8Bx


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Brown Handbag Tote Shoulder Womens Chicken Drawing Canvas Bag MyDaily qXSAx8Zww

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Pi Spreadshirt Bag Sequence Light Numerical Blue Spreadshirt Tote Pi Maths Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Girls Yuan School Ladies Handbags Bag Backpack Vintage Women's Daypacks Corduroy Khaki Travel x1qY14wg

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Spreadshirt Numerical Pi Light Bag Sequence Tote Maths Pi Spreadshirt Blue Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Womens Shoulder Brown Dune Dinidess Tan Dune Womens Bag YZZrqEIx