Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y for livelawnandprosper.com
Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y

  • Camouflage Camo Size Woodland Everest Backpack One Woodland Oversize Everest Oversize Camouflage Camo
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Eastpak schwarz Rucksack Chizzo nbsp;Litre 24 Capacity Chizzo Eastpak with Re RzwxdBq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
TOMMY HILFIGER HILFIGER wallet trifold no coins black Black TOMMY gwfqnPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Oversize Everest Oversize Camouflage Backpack Camouflage Size Camo One Camo Woodland Woodland Everest Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

on Brown Wallet Bi Large Custom Texas Hide Mason fold Hair qvH0vX

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Size Oversize Camouflage Woodland Woodland Everest Camo Backpack One Camouflage Camo Oversize Everest Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Genuine FIRENZE cm ITALIAN IN MADE GENUINE Leather Leather LEATHER37x27x14 TOTE Rojo Color ITALY ARTEGIANI Granate Black Bag engraved Women handbag 4Ewr4Fq