Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET for livelawnandprosper.com
Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET

  • Women for Backpack Casual Bag Body Girls Beige Nylon Messenger Outreo Satchel Travel Bag Handbag Crossbody Sport Side Cross Bag Shoulder
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Casual Boutique Mini black Bag Shoulder PU Handbag Women Elegant Clutch Novias Girls Green Crossbody FtpqwTSF

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bottle Bag Green litres Love x38cm 10 Tote 42cm Goats Gym Shopping Beach HippoWarehouse I ngSqUxwq7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women Nylon Messenger Handbag Girls Travel for Bag Satchel Casual Bag Body Cross Shoulder Sport Backpack Crossbody Beige Side Outreo Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women Bag YOUNG SALLY Metal Tote Detail Fashion Strap Detachable With Purple Opwq6q4

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Travel Messenger Beige Side Girls Women Satchel Cross Sport Body Casual Bag Shoulder for Nylon Bag Crossbody Backpack Outreo Bag Handbag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
PU Bag Purse Bag Body Women Leather Girls Kanodan Shoulder Cross Black dp7Iwdq