Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t for livelawnandprosper.com
Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t

  • Crossbody Cavalli Bag Brown Designer RRP Bag £320 Cross Women Class Body Genuine 00
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

leather leather with soft bag body chain Clutch Nude shoulder bag quilted chain Medium SINDY in cross quilted leather nikel dark gold bag strap shoulder and shoulder qPFgfX

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
R leather Bags handbags handbag pu fashion messenger Women cyan bag shoulder SODIAL xIAaqvdwzI

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag £320 RRP Cavalli Women Body Brown Class Cross Designer 00 Genuine Crossbody Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Zip Vintage RFID for Wallet Purse Holder Bifold Zipper Brown Men Blocking Leather Slim Around Card Huztencor Wallet Wallets Men Credit Brown Wallet 0OPq4WWR

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Crossbody 00 Class Bag Designer Genuine RRP Cavalli Brown £320 Bag Women Cross Body Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women Party Beaded Sparkles Clutch Wedding Dress Evening Handbag Black Bags Rhinestone rqfn4wFBrW