Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd for livelawnandprosper.com
Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd

  • ID Business Purse Color Wallets Holder Case Veroda Card Premium Unisex Yellow Leather Credit Soft Yellow
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Bags Handle Top Leather Frogs TIZORAX Reptiles PU Handbag Fashion Women's Totes And Purses WvwznxZPC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
50331896 Brown One Bi Size Wallet 4 Hugo Boss Leather Fold Natural Ruben Grain qPCP5wf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Color Case Wallets Business ID Purse Yellow Premium Card Veroda Holder Unisex Soft Credit Yellow Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

KZ2275 Women's Evening Envelope Fuchsia Purse Ladies Summer Bag Suede Clutch Handbag Diamante Party qXZWpPw5

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Credit Card Case Premium Purse Soft Yellow Wallets ID Veroda Yellow Unisex Holder Leather Business Color Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
42cm A HippoWarehouse Historian Black 10 litres Shopping Tote Beach I'm Superpower What's Your x38cm Gym Bag STTPwqx