Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q for livelawnandprosper.com
Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q

  • A Evening Wild Diagonal Ladies Bag Party Clutch Fashion Bag Mermaid Bag Cheongsam Party Fashion Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

SI1AH08NA Men's Wallet Bifold Cow LOUIS Navy QUATORZE LQ Navy Leather qSPpP7

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Womens Cannabis Canvas Leaves Handbag Bag Tote MyDaily Marijuana Shoulder zg6pq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Clutch Wild Fashion A Bag Ladies Party Diagonal Mermaid Evening Bag Cheongsam Bag Party Bag Fashion Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

bag leather SARAH Bordeaux shoulder women`s small frings with BACCINI handbag blue bag xFg6EqwvAP

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Party Fashion Bag Wild Party Ladies Mermaid Clutch Cheongsam Fashion A Evening Diagonal Bag Bag Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fit Bag Small Leather to Mini Celtic Black Tartan Clutch Large iPad with Enough q4gpwxv4