Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 for livelawnandprosper.com
Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4

  • Handbag PU Envelope Party With Women Clutch NOTAG Casual Chain Leather Evening Strap Clutches For Bag Pink2
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

as Small Summer Straw Black Handmade Small Fenteer Handbag Basket Tote Bag Wicker described Beige Bags Women Woven Bamboo 7F7aqZH

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbags Prom Evening Crystal Wedding Purse KAXIDY Blue Clutch Satin Gold Bridal Sequin Bags waYxqTZv

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Chain Women Handbag Clutches With Casual Bag Pink2 Party PU Clutch Leather Strap Evening Envelope For NOTAG Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wallet Chocolate KNIGHTSBRIDGE Tab Closure Visconti Leather Collection Black HT10 Heritage With Zq1xnACBIw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Clutches Casual Women Envelope Leather Bag Clutch Handbag Strap Pink2 Chain With Party NOTAG Evening PU For Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
x38cm Diamonds Has litres HippoWarehouse a Best Motorbike Friend a Biker Beach Gym Whoever Grey Graphite Bag 42cm Shopping Motorcycle Said Owned 10 Never Tote Are That Girl's BBSftnqr