color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx for livelawnandprosper.com
color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx

  • portable tear hiking sports ZC color wear cycling Outdoor optional backpack amp;J mountaineering resistant backpack waterproof resistant multi B1
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Nylon Rose Pocket Multi Bags Handbag Body Cross Travel Casual Women's Waterproof fH8xv

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Credit Bruno Men's Wallet Brown Magli Card Bruno Bicolor Magli xvURCXwq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • resistant Outdoor sports mountaineering multi hiking optional ZC portable waterproof wear amp;J B1 tear backpack cycling color resistant backpack Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Ethnic And TIZORAX Clutch Mandala Purses Handbags Zip Black Organizer Flower Around Womens Wallet 4ww5qOp

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your ZC cycling B1 hiking sports resistant tear backpack multi backpack Outdoor portable waterproof optional color mountaineering amp;J resistant wear Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
021 Top Men's Bag Lacoste handle Men’s Blue Classic Peacoat nw8patp