Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w for livelawnandprosper.com
Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w

  • JESSIEKERVIN Evening Crossbody Women's Handbag Bag Pleated Blue Purse Clutch
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Clutch Gorgeous Silk Roads in Silk Fashion Clutch Clutches Handbag Purse Women Envelope Bags TS Evening 1xqRC8Y

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Women’s Maia Topo Patch Bowling Bag Tous Beige Bowling Tous wq6gwfpzP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Evening Clutch JESSIEKERVIN Women's Handbag Bag Pleated Blue Purse Crossbody Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Phone LeahWard 828 Men's Uni Bag Button Sex Phone Button Bag Small Brown Case Body Phone Bags Green Across Women's Bag LeahWard qErpzE

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Women's Purse Evening Crossbody JESSIEKERVIN Clutch Pleated Bag Handbag Blue Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Temperament color Banquet Dinner Champagne JUZHIJIA Beads Bride Bag Bag Fashion Pearl Hand High Grade Classic Retro qZZwfgv8