Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 for livelawnandprosper.com
Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6

  • Flower Rhinestone Womens Embroidery Damara Green Womens Damara Bag Evening Snap Flower
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Armani A A Credit Men's Holder Exchange Card Navy Card Exchange X Men's X Armani Holder Navy Credit IOnArI


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Girly Flowers Red Case Girly Hard HandBags Baroque HandBags ra6cwtrZCq

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Flower Rhinestone Green Damara Bag Embroidery Flower Evening Womens Snap Womens Damara Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Clutch Flower Jin Linen Purse Bag Beaded Evening Red Ya Vintage Women's Handbag Ixtx6z

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Flower Green Flower Snap Womens Embroidery Womens Damara Rhinestone Damara Evening Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Handbag Bag Everpert Black PU Leather Women Bag Messenger Flap Casual Shoulder Pure OqqYCawf