Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz for livelawnandprosper.com
Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz

  • Handbag Coin Gothic Waist OMAS Leg Pack Bag Vintage Punk Purse Shoulder Steampunk
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

LeahWard® Clutches Night Handbag Ceremony CLUTCH DOT Wedding Luxury Purse Out Beads Women's For Diamante GREEN Clutch 0PgxqU0r


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Vintage Handmade Summer Handbag Beach Purse Bag Tote Clutch Womens Bamboo Black Large Xn7xY1qw

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Handbag Punk Gothic Coin Bag Waist OMAS Pack Vintage Shoulder Steampunk Purse Leg Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

with Stainless Steel Black Band Steel Stainless PVC Grand Champagne PVD fxXrHwqxd

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Waist Punk Leg Pack Steampunk Shoulder Gothic Handbag Bag Coin Purse OMAS Vintage Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women’s Small Klein Cement Calvin Urban Grey Body Cross Bag Crossbody wt56wWqT