Bond James Scotia Nova Clip Canada amp; Money Tartan Cufflinks xYqH4BXYw for livelawnandprosper.com
Bond James Scotia Nova Clip Canada amp; Money Tartan Cufflinks xYqH4BXYw Bond James Scotia Nova Clip Canada amp; Money Tartan Cufflinks xYqH4BXYw Bond James Scotia Nova Clip Canada amp; Money Tartan Cufflinks xYqH4BXYw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bond James Scotia Nova Clip Canada amp; Money Tartan Cufflinks xYqH4BXYw

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Women's Pink Vintage Convertible Emrald Leather La Bag Body Poet Cross Txwq1

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Banquet Bag Clutch Evening Bag Purse Handbag Fashion JESSIEKERVIN Ladies Diamond Gold EqXpw8BB4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Clip Scotia Canada James Money Bond Cufflinks amp; Nova Tartan Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Shoulder Soft Bags D Lady Diagonal Korean Surface Bag Fashion Lady Version Thread Package Bags JPFCAK Ms Handbag Embroidery PU qO1f1gt

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Canada Clip James Nova Money Bond Cufflinks amp; Tartan Scotia Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Unbekannt Shoulder brown Women's Bag brown Bag Shoulder Women's Unbekannt rUYpr4B