Cross Party Body Bag Bags LeahWard Evening Pink 454 Clutch Purse Clutch Prom Women's Xtqtx4aE for livelawnandprosper.com
Cross Party Body Bag Bags LeahWard Evening Pink 454 Clutch Purse Clutch Prom Women's Xtqtx4aE Cross Party Body Bag Bags LeahWard Evening Pink 454 Clutch Purse Clutch Prom Women's Xtqtx4aE Cross Party Body Bag Bags LeahWard Evening Pink 454 Clutch Purse Clutch Prom Women's Xtqtx4aE
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Cross Party Body Bag Bags LeahWard Evening Pink 454 Clutch Purse Clutch Prom Women's Xtqtx4aE

  • Bags Clutch 454 Prom Pink Women's Purse Bag LeahWard Party Clutch Cross Body Evening
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Sequined Boutique Paillette Cross Evening Pink Body Handbag Bag Women Novias Shiny Shoulder Black2 Bag tdqwIdU

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Purse Black Fashion Satchels R Class Ladies Leather Handbag Woman SODIAL Bag PU Orange Tote 1Uqgx

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Body Clutch Purse Bag LeahWard Prom Bags Party Cross Pink Women's 454 Evening Clutch Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wedding Multicolor Flada Cocktail Clutch Wallet Fashion Formal White for Evening Rhinestones Purse Purse Women White 4FPfx4

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Evening Prom LeahWard Cross Body Party Bag Purse Bags 454 Clutch Pink Clutch Women's Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
NICOLE Gray for Satchel amp;DORIS Bag Tote Simple Women PU Bag Crossbody Shoulder Color Leather Lady Handbags Dark Messenger Black rrd4Uqn7P