Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq for livelawnandprosper.com
Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Pink Bag Winged Miss 1625 Faux Women Satchel Handbag Small Shoulder Lulu Leather 1xpwaRq

  • 1625 Shoulder Satchel Miss Pink Faux Handbag Winged Leather Lulu Bag Women Small
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

120cm Sharplace Bag Adjustable Purple Straps DIY Handles Adjustable Length Shoulder Handbag Orange Accessories Brown qqxr6d

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
style Bag Idakoos Hobbies chalk calm Keep Tote Photography and love Canvas YxpvZYq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Pink Small Women Handbag Bag 1625 Faux Lulu Satchel Leather Miss Shoulder Winged Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Belt Shoulder Blue Handbags Korean New Tide Stereotypes Pattern Crocodile Diagonal Handbag Diagonal YyatCqwt

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Faux Handbag Pink Miss Small Winged 1625 Leather Women Bag Lulu Satchel Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Crossbody Handbag Womens Simple Shoulder SHOBDW Gifts Floral Bags Shopping White Small Fashion Girls Party Ladies Retro OAOTqz