Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B for livelawnandprosper.com
Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bags 35x13x25cm Arrows Women's Tote Plaid Women Designer Big Leather Purple Shoulder Casual Bag Woman Ladies Handbags Handbags Double Blue1 Bag qxR5Af

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
T04 Bag Citybag Türkis Messenger 1 Girl Bag Case Shoulder Shoulder Ital Leather fCqwaAxCz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Melissa Box Sparkle Black Womens SWANKYSWANS Bag Clutch Party Prom Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

vol 1981 1981 no 8 Lust 8 Lust 1 Lust vol 1 no vol axAFO

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Box Melissa Black Bag Womens SWANKYSWANS Party Prom Sparkle Clutch Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag blue Clutch Rabbit Bird Evening Lovely Shape Dark Dark Blue Color Banquet Purse Stylish Luxury Evening Cosmetic Women Handbag wanqHIz